Skip to main content

International Journal of Phytomedicine and Phytotherapy

Table 1 Primer sequence of various genes used for qPCR

From: Self-emulsifying formulation of Spinacia oleracea reduces the dose and escalates bioavailability of bioactive compounds to accelerate fracture repair in rats

Gene Symbol Gene Name Primer Sequence Accession Number
RUNX2 Runt-related transcription factor2 F-CCACAGAGCTATTAAAGTGACAG
R-AACAAACTAGGTTTAGAGTCATCA
NM_053470
BMP2 Bone morphogenetic protein2 F- CCCCTATATGCTCGACCTGT
R-AAAGTTCCTCGATGGCTTCTT
NM_017178.1
OCN Osteocalcin F-ATAGACTCCGGCGCTACCTC
R-CCAGGGGATCTGGGTAGG
NM-013414
COL1 TypeI Collagen F- CATGTTCAGCTTTGTGGACCT
R- GCAGCTGACTTCAGGGATGT
NM_053304
BMP4 Bone morphogenetic protein4 F-GCATCCCAGAGAATGAGGTG
R-CCACCTGCTCCCGAAATAG
NM_012827.2