Skip to main content

International Journal of Phytomedicine and Phytotherapy

Table 1 Gene Expression Analysis by RT-PCR

From: Bridelia ferruginea Benth leaves attenuates diabetes nephropathy in STZ-induced rats via targeting NGAL/KIM-1/cystatin c gene

S/N Gene Sequence for Forward Primer Sequence for Reverse Primer
1 KIM-1 GGATGAGGATGGGTTTCTTAGG CCTGCTCTCTCTCCTTTCTTTC
2 NGAL GACCTAGTAGCTGCTGAAACC GAGGATGGAAGTGACGTTGTAG
3 Cystatin C GCTGGTCGTGGAAAGGACAG CACTTCAGGTCTGCGATGGAA
4 Β-actin AGACAGCCGCATCTTCTTGT CTTGCCGTGGGTAGAGTCAT